Meddelande

Du befinner dig just nu på en äldre version av Pluggakuten, gamla.pluggakuten.se. Nya Pluggakuten lanserades den 6 februari 2017 och du finner forumet på www.pluggakuten.se.

På gamla.pluggakuten.se kan du fortfarande läsa frågorna och svaren som ställts, men du kan inte skapa ett nytt konto eller nya trådar. Är du redan medlem kan du däremot fortfarande logga in och svara i befintliga trådar. Nya frågor och nytt konto skapar du på det nya forumet, välkommen dit!

[KE 2/B] Peptidkedjor

akagustafsson
Medlem

Offline

Registrerad: 2016-04-12
Inlägg: 21

[KE 2/B] Peptidkedjor

Hej,
jag har en fråga angående peptidkedjor. Frågan och mitt svar finnes här under.


En DNA-sekvens ser ut på följande sätt:
…GTGTTACCTCGTGCAGTTCATAGTT…
DNA-sekvensen styr bildningen av en peptidkedja, vilken?
Ledning: Bestäm först vilket m-RNA som bildas och därefter vilken peptidkedja detta motsvarar. Börja avläsningen av m-RNA med startkodon, dvs AUG.

SVAR:
3’ GTGT TAC CTC GTG CAG TTC ATA GTT ‘5
5’ CACAAUGGAGCACGUCAAGUAUCAA’3
Tyr-Leu-Val-Gln-Phe-Ile-Val

jag är lite förvirrad över om jag ska översätta DNA kedjan som står först eller mRNA kedjan som står under (gjorde det senare), i läroboken står det: 'förväxla inte denna tabell med liknande tabeller där man istället för DNA-tripletter anger mRNA-kodoner. En kodon är en tripletts komplementär.'

Är det någon som vet om jag gjort rätt och namngett rätt kedja?

Tack!

 
SvanteR
Medlem

Offline

Registrerad: 2015-09-24
Inlägg: 626

Re: [KE 2/B] Peptidkedjor

akagustafsson skrev:

Hej,
jag har en fråga angående peptidkedjor. Frågan och mitt svar finnes här under.


En DNA-sekvens ser ut på följande sätt:
…GTGTTACCTCGTGCAGTTCATAGTT…
DNA-sekvensen styr bildningen av en peptidkedja, vilken?
Ledning: Bestäm först vilket m-RNA som bildas och därefter vilken peptidkedja detta motsvarar. Börja avläsningen av m-RNA med startkodon, dvs AUG.

SVAR:
3’ GTGT TAC CTC GTG CAG TTC ATA GTT ‘5
5’ CACAAUGGAGCACGUCAAGUAUCAA’3
Tyr-Leu-Val-Gln-Phe-Ile-Val

jag är lite förvirrad över om jag ska översätta DNA kedjan som står först eller mRNA kedjan som står under (gjorde det senare), i läroboken står det: 'förväxla inte denna tabell med liknande tabeller där man istället för DNA-tripletter anger mRNA-kodoner. En kodon är en tripletts komplementär.'

Är det någon som vet om jag gjort rätt och namngett rätt kedja?

Tack!

Jag tycker frågan är lite underligt ställd, så jag är osäker på vad det är tänkt att det rätta svaret ska vara. Har du fått några mer detaljer, eller har du skrivit all information du fick?

Jag resonerar så här när jag läser din uppgift. DNA är ju dubbelsträngat i kromosomerna, men när man anger sekvensen gör man det bara för en sträng, och det gäller att hålla reda på vilken. Dessutom måste man veta vilken riktning man skriver sekvensen i.

Om man inte säger något speciellt, så skriver man alltid ut den kodande DNA-sekvensen (som kallas för "sense" på engelska). Det är den som inte basparar med mRNA. Det gör man för att den liknar mRNA. Man behöver bara byta ut T mot U så vet man hur mRNA ser ut.

Det är också så att om man inte skriver något speciellt så skriver man alltid DNA-sekvenser från 5' till 3'. Det är en konvention som följs av alla som jobbar med DNA.

Om man följer de vanliga reglerna för DNA-sekvenser så ska din sekvens förstås så här:

5'-GTGTTACCTCGTGCAGTTCATAGTT-3'

Komplementär DNA-sträng (inte utskriven i uppgiften)
3'-CACAATGGAGCACGTCAAGTATCAA-5'

Och det mRNA som bildas blir detta:
5'-GUGUUACCUCGUGCAGUUCAUAGUU-3'

Men nu stöter vi på problem, för här finns ingen startkodon, dvs ingen AUG, och uppgiften kan inte lösas.

Alltså har den som gjort din uppgift inte följt alla konventioner för hur man skriver DNA-sekvenser. Men då blir det svårt att gissa hur hen har tänkt i stället. Men jag kan tänka mig två möjligheter.

Alternativ 1:

Ditt DNA är "antisense strand", skrivet 5' -> 3' (bryter mot konventionen att ange sekvens för "sense strand" om inget annat sägs)

5'-GTGTTACCTCGTGCAGTTCATAGTT-3'
3'-CACAAUGGAGCACGUCAAGUAUCAA-5'

Basparande mRNA blir som jag har skrivit ut. Eftersom mRNA läses från 5' av ribosomen finns det en AUG här.

Alternativ 2 (detta har du gjort):

Ditt DNA är "antisense strand", skrivet 3' -> 5' (bryter både mot konventionen att ange sekvens för "sense strand" och skriva 5' -> 3' om inget annat sägs)

3'-GTGTTACCTCGTGCAGTTCATAGTT-5'
5'-CACAAUGGAGCACGUCAAGUAUCAA-3'

Här finns också en AUG och det går att komma vidare.

Kanske har du fått mer information som inte kom med när du skrev din fråga? Annars tycker jag att din uppgift var lite slarvigt formulerad. Att DNA har två strängar, men att bara den ena används (oftast) av RNA-polymeras är förvirrande, och det gäller att vara noggrann med uppgiften för att den som gör den ska fatta.

 
akagustafsson
Medlem

Offline

Registrerad: 2016-04-12
Inlägg: 21

Re: [KE 2/B] Peptidkedjor

Hej,

Tack så jättetycket för svaret!
Det är hela uppgiften jag skrivit med, var lite förvirrande kan jag själv tycka.
I vilket fall så kommer jag behålla mitt svar och se vad dem säger, dvs alternativ 2. Det verkade mest 'rimligt' om jag läser i boken hur dem gjort, men uppgiften i sig finns inte att finna, såklart!

Tack

 


Sidfot

Powered by PunBB
© Copyright 2002–2005 Rickard Andersson

Powered by Mattecentrum
 |  Denna sida använder cookies |  Kontakta oss |  Feedback |